View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7934_low_6 (Length: 378)
Name: NF7934_low_6
Description: NF7934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7934_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 15 - 368
Target Start/End: Original strand, 34902598 - 34902951
Alignment:
| Q |
15 |
catcagttagaacaagcaaaccgccggtgatcgacaacaaagatataaccacatatctctcatcaatttcatacccaaaaatcaccaaaggtgtaactct |
114 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902598 |
catccgttagaacgagcaaaccggcggtgatcgacaacaaagatataaccacatatctctcatcaatttcatacccaaaaatcaccaaaggtgtaactct |
34902697 |
T |
 |
| Q |
115 |
taggaaatataaatacacccatgcaatcatcatcacaattaatatgatcaatgagatagggtgttctagtaagctaaggaaaatagtaagcaacatggtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902698 |
taggaaatataaatacacccatgcaatcatcatcacaattaatatgatcaatgagatagggtgttctagtaagctaaggaaaatagtaagcaacatggtg |
34902797 |
T |
 |
| Q |
215 |
ataacataatttgcgcgaaaatgtttggcattggtgttgattctttgaattgtgtcatagaaagatgatggaagtttgaaatgagaaaattggatcattt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902798 |
ataacataatttgcgcgaaaatgtttggcattggtgttgattctttgaattgtgtcatagaaagatgatggaagtttgaaatgagaaaattggatcattt |
34902897 |
T |
 |
| Q |
315 |
cattccatggtcttgttacgcctatattgtcttggaagcgctctttcgtctctg |
368 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34902898 |
ctttccatggtcttgttacgcctatattgtcttggaagcgctctttcgcctctg |
34902951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University