View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7935_high_23 (Length: 208)
Name: NF7935_high_23
Description: NF7935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7935_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 2176971 - 2176810
Alignment:
| Q |
20 |
atgaaaaggatgagttgatgaaaggaagaagaagctgtggtagtaattatattgatgaattattaggagaaagagaaaggatgaatgttactagagtgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176971 |
atgaaaaggatgagttgatgaaaggaagaagaagctgtggtagtaattatattgatgaattattaggagaaagagaaaggatgaatgttactagagtgaa |
2176872 |
T |
|
| Q |
120 |
ggtgaagatgacaaaggaagaagcagctaagttactgtcaaaatttaaatgcaaagaaggag |
181 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176871 |
ggtaaagatgacaaaggaagaagcagctaagttactgtcaaaatttaaatgcaaagaaggag |
2176810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University