View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7935_low_14 (Length: 429)
Name: NF7935_low_14
Description: NF7935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7935_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 136 - 412
Target Start/End: Complemental strand, 34365240 - 34364970
Alignment:
| Q |
136 |
atctaatttactctgacaatgccctcttt-taactaacaatacacggataacgtttccaccatcagattctgattgagttagaactcttgtcatcagaaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||| || |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34365240 |
atctaatttactctgacaatgccctcttgctaaccaacaatacacgtat-------ccacaatcagattctgattgagttagaactcttgtcttcagaaa |
34365148 |
T |
|
| Q |
235 |
ccttcatttttattttatgatggatgatattattcttagggaagtgtcacacaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagtta |
334 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34365147 |
ccttcattttt-ttttatgatggatgatattattcttagggaagtgtcacacaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagtta |
34365049 |
T |
|
| Q |
335 |
acactgagcctaatctagacagacaagggtttgatgat-ggaatgtcaaaactcaaaatttcaatcctccattatagta |
412 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
34365048 |
acactgagcctaatctagacagacaggggtttgatgatgggaatgtcaaaactcaatatttcaatcttccattagagta |
34364970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 26215646 - 26215613
Alignment:
| Q |
25 |
gatccgcttgtttcttttcacaaacctcagtttt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26215646 |
gatccgcttgtttcttttcacaaacctcagtttt |
26215613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 18561000 - 18561033
Alignment:
| Q |
25 |
gatccgcttgtttcttttcacaaacctcagtttt |
58 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
18561000 |
gatctgcttgtttcttttcacaaacctcagtttt |
18561033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 18386493 - 18386460
Alignment:
| Q |
25 |
gatccgcttgtttcttttcacaaacctcagtttt |
58 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
18386493 |
gatctgcttgtttcttttcacaaacctcagtttt |
18386460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University