View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7935_low_21 (Length: 272)

Name: NF7935_low_21
Description: NF7935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7935_low_21
NF7935_low_21
[»] chr1 (2 HSPs)
chr1 (81-260)||(3765891-3766071)
chr1 (1-37)||(3766115-3766151)
[»] chr3 (3 HSPs)
chr3 (111-155)||(48388470-48388514)
chr3 (111-155)||(9995181-9995225)
chr3 (111-155)||(10359321-10359365)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 81 - 260
Target Start/End: Complemental strand, 3766071 - 3765891
Alignment:
81 gcatttggtgcagatgtggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgcaaa-aaaatatatatacttcat 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
3766071 gcatttggtgcagatgtggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgcaaaaaaaaaatatatacttcat 3765972  T
180 actttttttatcatgattatttgtgannnnnnnnnnnataaaacttc--tgttttgaattcaggcttcagaccaaccaatatt 260  Q
    ||||||||||||||||||||||||||           ||||||||||  ||||||||||||||||||||||||||||||||||    
3765971 actttttttatcatgattatttgtga--tttttttttataaaacttctatgttttgaattcaggcttcagaccaaccaatatt 3765891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 3766151 - 3766115
Alignment:
1 atacatgaaatcgtgggtgacatttgactaacatatg 37  Q
    |||||||||||||||||||||||||||||||||||||    
3766151 atacatgaaatcgtgggtgacatttgactaacatatg 3766115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 48388514 - 48388470
Alignment:
111 actcatgtaccatcatttgctgattcatggggatgggttatggta 155  Q
    |||||||||||||| ||||||||| | ||||||||||||||||||    
48388514 actcatgtaccatcttttgctgatacttggggatgggttatggta 48388470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 155
Target Start/End: Original strand, 9995181 - 9995225
Alignment:
111 actcatgtaccatcatttgctgattcatggggatgggttatggta 155  Q
    |||||||||||||| ||||||||| | |||||||||||| |||||    
9995181 actcatgtaccatcttttgctgatacttggggatgggttttggta 9995225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 10359365 - 10359321
Alignment:
111 actcatgtaccatcatttgctgattcatggggatgggttatggta 155  Q
    |||||||||||||| ||||||||| | |||||||||||| |||||    
10359365 actcatgtaccatcttttgctgatacttggggatgggttttggta 10359321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University