View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7937_low_4 (Length: 294)
Name: NF7937_low_4
Description: NF7937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7937_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 128 - 218
Target Start/End: Original strand, 31094484 - 31094574
Alignment:
| Q |
128 |
ttgaacactgttaaaattattgtgtatttacttttctttgattgtaacatttgtttctgatttgaatcttatgtatattgattcaaagatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31094484 |
ttgaacactgttaaaattattgtgtatttactttgctttgattgtaacatttgtttctgatttgaatcttatgtatattgattcaaagatg |
31094574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 31094308 - 31094336
Alignment:
| Q |
1 |
atatgcctaaatgtgatatttgtcaggta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31094308 |
atatgcctaaatgtgatatttgtcaggta |
31094336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University