View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7937_low_4 (Length: 294)

Name: NF7937_low_4
Description: NF7937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7937_low_4
NF7937_low_4
[»] chr2 (2 HSPs)
chr2 (128-218)||(31094484-31094574)
chr2 (1-29)||(31094308-31094336)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 128 - 218
Target Start/End: Original strand, 31094484 - 31094574
Alignment:
128 ttgaacactgttaaaattattgtgtatttacttttctttgattgtaacatttgtttctgatttgaatcttatgtatattgattcaaagatg 218  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31094484 ttgaacactgttaaaattattgtgtatttactttgctttgattgtaacatttgtttctgatttgaatcttatgtatattgattcaaagatg 31094574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 31094308 - 31094336
Alignment:
1 atatgcctaaatgtgatatttgtcaggta 29  Q
    |||||||||||||||||||||||||||||    
31094308 atatgcctaaatgtgatatttgtcaggta 31094336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University