View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7940_high_8 (Length: 241)

Name: NF7940_high_8
Description: NF7940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7940_high_8
NF7940_high_8
[»] chr4 (1 HSPs)
chr4 (7-223)||(2608532-2608748)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 2608748 - 2608532
Alignment:
7 gtttggtgttttccttgttttagaatccacgtggccgggggcatgtccgaagataaacacggtggcgccacatatgaaccgaccgttgaaatatatgaat 106  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2608748 gtttggtgttttccttgttttagaatctacgtggccgggggcatgtccgaagataaacacggtggcgccacatatgaaccgaccgttgaaatatatgaat 2608649  T
107 cttgtattgacacgtggaaaatcgttggatcgatgccggttgaattttcggttaggctaacggtttggacaccaaatgagaatgtgtgtatagagggaag 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
2608648 cttgtattgacacgtggaaaatcgttggatcgatgccggttgaattttcggttaggctaacggtttggacaccaaatgagaatgtgtgtatagagggaac 2608549  T
207 aagaacaacaacgttgt 223  Q
    |||||||||||| ||||    
2608548 aagaacaacaacattgt 2608532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University