View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7940_low_10 (Length: 241)
Name: NF7940_low_10
Description: NF7940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7940_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 2608748 - 2608532
Alignment:
| Q |
7 |
gtttggtgttttccttgttttagaatccacgtggccgggggcatgtccgaagataaacacggtggcgccacatatgaaccgaccgttgaaatatatgaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608748 |
gtttggtgttttccttgttttagaatctacgtggccgggggcatgtccgaagataaacacggtggcgccacatatgaaccgaccgttgaaatatatgaat |
2608649 |
T |
 |
| Q |
107 |
cttgtattgacacgtggaaaatcgttggatcgatgccggttgaattttcggttaggctaacggtttggacaccaaatgagaatgtgtgtatagagggaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608648 |
cttgtattgacacgtggaaaatcgttggatcgatgccggttgaattttcggttaggctaacggtttggacaccaaatgagaatgtgtgtatagagggaac |
2608549 |
T |
 |
| Q |
207 |
aagaacaacaacgttgt |
223 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
2608548 |
aagaacaacaacattgt |
2608532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University