View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7940_low_13 (Length: 223)
Name: NF7940_low_13
Description: NF7940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7940_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 43666009 - 43665830
Alignment:
| Q |
18 |
tgaagggagaaaggaaatggacaaaatttaacattaaaagaccaatgacataattttgcctaaaatatatgcaagatgtggtagnnnnnnnngttagtta |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
43666009 |
tgaagggagaaaggaaatggacaaa-tttaacattaaaagaccaatgacataattttgtctaaaatatatgcaagatgtggtagttttttt-gttagtta |
43665912 |
T |
 |
| Q |
118 |
atgtaattttaaaattagaaaactatagaagaacaatttcccccctagctactaaataacctgcaattgtaaaggaatgcatcatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665911 |
atgtaattttaaaattagaaaactatagaagaaccatttccccc----ctactaaataacctgcaattgtaaaggaatgcatcatg |
43665830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University