View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7940_low_14 (Length: 220)
Name: NF7940_low_14
Description: NF7940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7940_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 47 - 204
Target Start/End: Complemental strand, 17849220 - 17849063
Alignment:
| Q |
47 |
tgtgtttctatctgtttcacaagtaactttatttggttttcccattttgaaagcatttcatttgcatttgatacatgagcagtccactacctatttatag |
146 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17849220 |
tgtgtttctctctgtttcacaggtaattttatttggttttcccattttgaaagcatttcatttgcatttgatacatgagcagtccactgcctatttatag |
17849121 |
T |
 |
| Q |
147 |
ctaaggtatcctctcaatgtgggacttattactatctctctattgaacttcgtatatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17849120 |
ctaaggtatcctctcaatgtgggacttattactatctctctattcaacttcgtatatt |
17849063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 196
Target Start/End: Complemental strand, 1848212 - 1848177
Alignment:
| Q |
161 |
caatgtgggacttattactatctctctattgaactt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1848212 |
caatgtgggacttattactatctctctattcaactt |
1848177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 196
Target Start/End: Complemental strand, 1842860 - 1842827
Alignment:
| Q |
163 |
atgtgggacttattactatctctctattgaactt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
1842860 |
atgtgggacttattactatctctctattcaactt |
1842827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 165
Target Start/End: Complemental strand, 1845238 - 1845198
Alignment:
| Q |
125 |
gcagtccactacctatttatagctaaggtatcctctcaatg |
165 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
1845238 |
gcagtccactacctatttataggtaaggtttcctcccaatg |
1845198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University