View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7940_low_7 (Length: 336)
Name: NF7940_low_7
Description: NF7940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7940_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 31418088 - 31418221
Alignment:
| Q |
17 |
agttacaaaaactacacctcaactttattatatttcatattagtaaaaagtccatcccatacttcaagaaaaaatcagaaggggatagaattagagatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31418088 |
agttacaaaaactacacctcaactttattatatttcatattagtaaaaagtccatcccatacttcaagaaaaaatcagaaggggatagaattagagatgt |
31418187 |
T |
|
| Q |
117 |
tacaagcacaattagattcttaatcctcatatta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31418188 |
tacaagcacaattagattcttaatcctcatatta |
31418221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 212 - 324
Target Start/End: Original strand, 31418271 - 31418383
Alignment:
| Q |
212 |
tatctatgggttatcatcctcaaaaactactgctaaaccagtcacaaccttaaccccagtcaatgaacctttaggcttcaactccggcggcttccattcg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31418271 |
tatctatgggttatcatcctcaaaaactactgctaaaccagtcacaaccttaaccccagtcaatgaacctttaggcttcaactccggcggcttccattcg |
31418370 |
T |
|
| Q |
312 |
ataaccaccttct |
324 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31418371 |
ataaccaccttct |
31418383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University