View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7941_high_3 (Length: 245)
Name: NF7941_high_3
Description: NF7941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7941_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 32504525 - 32504559
Alignment:
| Q |
190 |
aaggtgacagtcttaacaattgtaacaagtaacaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504525 |
aaggtgacagtcttaacaattgtaacaagtaacaa |
32504559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University