View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7941_low_3 (Length: 245)
Name: NF7941_low_3
Description: NF7941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7941_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36086086 - 36085864
Alignment:
| Q |
1 |
ttacttctaaggaacattctgtttcaatgagatctcttgtggtgagtggattttacgtgagcttgatcatgcaggtaggttcttctgttgtttcggattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36086086 |
ttacttctaaggaacattctgtttcaatgagatctcttgtggtgagtggattttacgtgagcttgatcatgcaggtaggttcttctgttgtttcggattg |
36085987 |
T |
 |
| Q |
101 |
tttatgtctctcttttttattatgatcattggtttgaactttgtgtttcttattataactttgatgactgattcctggaaatattatatcttttgcatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36085986 |
tttatgtctctcttttttattatgatcattggtttgaactttgtgtttcttattataactttgatgactgattcctggaaatattatatcttttgcatga |
36085887 |
T |
 |
| Q |
201 |
tgttatatgtagaatgttaactt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36085886 |
tgttatatgtagaatgttaactt |
36085864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 40730108 - 40730144
Alignment:
| Q |
187 |
tatcttttgcatgatgttatatgtagaatgttaactt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40730108 |
tatcttttgcatgatgttatatgtagaatgttaactt |
40730144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University