View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_high_18 (Length: 312)
Name: NF7943_high_18
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_high_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 3 - 312
Target Start/End: Complemental strand, 13116877 - 13116565
Alignment:
| Q |
3 |
accggtgttgttaataagaccctccatgttttgggtgcccccgttggagaaagtgtcgggaggtggcttttggcgacgagcaacggcattggaaccattg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13116877 |
accggtgttgttaataagaccctccatgttttgggtgcccccgttggagaaagtgtcgggaggtggcttttggcgacgagcaacggcactggaaccattg |
13116778 |
T |
 |
| Q |
103 |
cggttgcgtcgtcgtggttgtcgaggttgtggttcttccacatgatcctcatcaaggatgcgcagcaattgcatcaatgatgccattgttagcaagctag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| | || ||| |
|
|
| T |
13116777 |
cggttgcgtcgtcgtggttgtcgaggttgtggttcttccacatgatcctcatcaaggaggttcagcaattgcatcaatgatgccattgttaactagttag |
13116678 |
T |
 |
| Q |
203 |
cttggaagagctaaagttttagatgcctt-gtaggagatgttgcacccatctatatatag--gatatgtatatgacttgcttaaggaataatatgtagga |
299 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13116677 |
cttggaagggctcaagttttagatgccttggtaggagatgttgcacccatctatatatagaatatatgtatatgacttgcttaaggaataatatgtagga |
13116578 |
T |
 |
| Q |
300 |
ccctgttaacttg |
312 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13116577 |
ccctgttaacttg |
13116565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University