View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_high_24 (Length: 232)
Name: NF7943_high_24
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_high_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 7440822 - 7440587
Alignment:
| Q |
1 |
tattactgctatgattcagttaacaatattacctctgatgagccataatacaaccggcccttgccttctttaatgttttgcatatattaggtatacttta |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
7440822 |
tattactactatgattcagttaacaatattacctctgatgagccatactactaccgccccttgccttatttaatgtcttgcatatattaggtaaacttta |
7440723 |
T |
 |
| Q |
101 |
acaacttagaaatcaaaattaaagataatttataacgcttgatttcctcaattcactctagcc----atttaacaaagaagaaaattgtgatgacttata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7440722 |
acaacttagaaatcaaaattaaagataatttataacacttgatttcctcaattcactctagccattaatttaacaaagaagaaaattgtgatgacttata |
7440623 |
T |
 |
| Q |
197 |
aaggagtcaaagcaatcaatacctaaacatgtttta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440622 |
aaggagtcaaagcaatcaatacctaaacatgtttta |
7440587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University