View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_low_22 (Length: 362)
Name: NF7943_low_22
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 17 - 348
Target Start/End: Complemental strand, 56471267 - 56470935
Alignment:
| Q |
17 |
actctctttgtaaaggttagtttattagttaattaactactcggtgcaatattatatgtgggggtctgtgtcatccctattacaaatgcatatccttaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471267 |
actctctttgtaaaggttagtttattagttaattaactactcggtgcaatattatatgtgggggtctgtgtcatccctattacaaatgcatatccttaaa |
56471168 |
T |
|
| Q |
117 |
tgacatttattatagtttttaacgtggaaaaatggcttgagtttttcagatttttggctcaattttcggggttgcagctggttttgttgtgggtaaggaa |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471167 |
tgacatttattatagtttttaatgtggaaaaatggcttgagtttttcagatttttggctcaattttcggggttgcagctggttttgttgtgggtaaggaa |
56471068 |
T |
|
| Q |
217 |
ggacctatggtgcatactggtgcttgcataggaaatctacttggacaaggtggttcaa-aaaatatggactgacctggaaagggttcagatattttaaaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471067 |
ggacctatggtgcatactggtgcttgcataggaaatctacttggacaaggtggttcaaaaaaatatggactgacctggaaagggttcagatattttaaaa |
56470968 |
T |
|
| Q |
316 |
atgacagagatcgaagggatttgatcacgtgtg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
56470967 |
atgacagagatcgaagggatttgatcacatgtg |
56470935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 163 - 346
Target Start/End: Original strand, 153697 - 153881
Alignment:
| Q |
163 |
cagatttttggctcaattttcggggttgcagctggttttgttgtgggtaaggaaggacctatggtgcatactggtgcttgcataggaaatctacttggac |
262 |
Q |
| |
|
||||| ||||| || ||||| || ||||| |||||||| ||||||| || |||||||| ||||| ||||| ||||||||||| | ||| |||| |||| |
|
|
| T |
153697 |
cagatatttggttcgattttaggagttgctgctggtttcattgtggggaaagaaggacccatggttcatacaggtgcttgcattgctaatttactcggac |
153796 |
T |
|
| Q |
263 |
aaggtggttc-aaaaaatatggactgacctggaaagggttcagatattttaaaaatgacagagatcgaagggatttgatcacgtg |
346 |
Q |
| |
|
|||||||||| |||||| |||| ||||||||| || ||||||| || |||||||| |||||| | ||||||||||||||||| |
|
|
| T |
153797 |
aaggtggttcgcgtaaatatcgactcacctggaaatggctcagatacttcaaaaatgatagagataggagggatttgatcacgtg |
153881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University