View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_low_26 (Length: 321)
Name: NF7943_low_26
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 41978491 - 41978198
Alignment:
| Q |
16 |
acatcatcgagacttcccatatttttctttgaattggattttgtatactttccgggagatagcggtgaatcttgttgggaataagctaacaaactagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978491 |
acatcatcgagacttcccatatttttctttgaattggattttgtatacttcccgggagatagcggtgaatcttgttgggaataagctaacaaactagaat |
41978392 |
T |
 |
| Q |
116 |
ggattccaagccttgacttgctgacaggatcagtaagaattggagaagcatgagaaggctgcaaatccatttcacctaactaaactacttaaaagggtat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978391 |
ggattccaagccttgacttgctgacaggatcagtaagaattggagaagcatgagaaggctgcaaatccatttcacctaactaaactacttaaaagggtat |
41978292 |
T |
 |
| Q |
216 |
gtaaatatgtatgaacagaggc--nnnnnnnnngtttgtgttcaatgttatgatgagttttgtcgatgaacagaactgatttatacgaatcttt |
307 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978291 |
gtaactatgtatgaacagaggcaaaaaaaaaaagtttgtgttcaatgttatgatgagttttgtcgatgaacagaactgatttatacgaatcttt |
41978198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University