View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_low_32 (Length: 280)
Name: NF7943_low_32
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 36873185 - 36873413
Alignment:
| Q |
1 |
cctaaataatgttgtgaatttcatatcactgaaatatttattaatttaaaaataaatagtctactttgagaaggattttaacaattttacgattcaaaga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36873185 |
cctaaataatattgtgaatttcatatcattgaaatatttattaatttaaaaataaatagtctactttgagaaggattttaacaattttacgattcaaaga |
36873284 |
T |
 |
| Q |
101 |
attacatattagaaaagtgattttaatgtgaccttgttttcaaccgagttaccgaca----ccctcctactgcctttattattcatatacatacataagg |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36873285 |
attacatattagaaaagtgactttaatgtgaccttattttcaaccgagttaccgacaccctccctcctactgcctttattattcat----atacataagc |
36873380 |
T |
 |
| Q |
197 |
ttgttgttggggtgagtgaggggatcacacatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36873381 |
ttgttgttggggtgagtgaggggatcacacatg |
36873413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 259
Target Start/End: Original strand, 36873423 - 36873458
Alignment:
| Q |
224 |
cacatgcacactcaccaccggcttgaagagccacat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36873423 |
cacatgcacactcaccaccggcttgaagagccacat |
36873458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University