View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_low_38 (Length: 230)
Name: NF7943_low_38
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 155
Target Start/End: Complemental strand, 7440459 - 7440313
Alignment:
| Q |
18 |
atgaagattaagagtagtttataacgagacactcttctaaactctagcacgttttaataccaaaaacggacaatacc---------nnnnnnnnncggtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7440459 |
atgaagattaagagtagtttataacgagacactcttctaaactctagcacgttttaataccaaaaacggacaataccaaaaaacaaaaaaaaaaacggtg |
7440360 |
T |
 |
| Q |
109 |
cagcacgcggataaagttccgaacaaaacacaactataagattatta |
155 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7440359 |
cagcacgtggattaagttccgaacaaaacacaactataagattatta |
7440313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 211
Target Start/End: Complemental strand, 7440314 - 7440274
Alignment:
| Q |
171 |
taagaatgatgagaaaaaagattcattagcctatcctgttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440314 |
taagaatgatgagaaaaaagattcattagcctatcctgttc |
7440274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University