View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7943_low_40 (Length: 224)

Name: NF7943_low_40
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7943_low_40
NF7943_low_40
[»] chr2 (1 HSPs)
chr2 (1-206)||(34101304-34101509)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 34101509 - 34101304
Alignment:
1 ttgatttcatgatccatcacaatatggagattgtgaggaatctgtgcttgaagtaacggtttcgcaaaatcgttaagtttggaaatcgtgtacacgtgga 100  Q
    ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||    
34101509 ttgatttcatgatccatcacaatgtggagattgtaaggaatctgtgcttgaagtaacgatttcgcaaaatcgtcaagtttggaaatcgtgtacacgtgga 34101410  T
101 agtagtttttcatcttcttcatttcgtcggtgtcgttgttgtcgtgagtcgtggtgcagacgtggaggaggactacggtgtcgtgtggttggatgtggtg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
34101409 agtagtttttcatcttcttcatttcgtcggtgtcgttgttgtcgtgtgtcgtggtgcagacgtggaggaggactacggtgtcgtggggttggatgtggtg 34101310  T
201 ttggat 206  Q
    ||||||    
34101309 ttggat 34101304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University