View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7943_low_40 (Length: 224)
Name: NF7943_low_40
Description: NF7943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7943_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 34101509 - 34101304
Alignment:
| Q |
1 |
ttgatttcatgatccatcacaatatggagattgtgaggaatctgtgcttgaagtaacggtttcgcaaaatcgttaagtttggaaatcgtgtacacgtgga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34101509 |
ttgatttcatgatccatcacaatgtggagattgtaaggaatctgtgcttgaagtaacgatttcgcaaaatcgtcaagtttggaaatcgtgtacacgtgga |
34101410 |
T |
 |
| Q |
101 |
agtagtttttcatcttcttcatttcgtcggtgtcgttgttgtcgtgagtcgtggtgcagacgtggaggaggactacggtgtcgtgtggttggatgtggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34101409 |
agtagtttttcatcttcttcatttcgtcggtgtcgttgttgtcgtgtgtcgtggtgcagacgtggaggaggactacggtgtcgtggggttggatgtggtg |
34101310 |
T |
 |
| Q |
201 |
ttggat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
34101309 |
ttggat |
34101304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University