View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7944_high_7 (Length: 221)
Name: NF7944_high_7
Description: NF7944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7944_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 25 - 206
Target Start/End: Complemental strand, 39181023 - 39180837
Alignment:
| Q |
25 |
tgcaccttcatatatgattctagccactttaaataatcttttgtactctccgatgtttcattgaattcttaaaaaccagtacttctg-----aaggagac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
39181023 |
tgcaccttcatatatgattctagccactttaaataatcttttgtactctccgacgtttcattgaattcttaaaaacgagtacttctgttctgaaggagac |
39180924 |
T |
 |
| Q |
120 |
ttcttttgattaaaagatagactcatgagggggtataataaaaaattcaaattcaacatcattaatatttgtaaaacaacaaaaact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39180923 |
ttcttttgattaaaagatagactcatgagggggtataataaaaaattcaaattcaacatcattaatatttgtagaacaacaaaaact |
39180837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 27 - 142
Target Start/End: Complemental strand, 39178711 - 39178596
Alignment:
| Q |
27 |
caccttcatatatgattctagccactttaaataatcttttgtactctccgatgtttcattgaattcttaaaaaccagtacttctgaaggagacttctttt |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||| | || ||||| |||| | ||||| ||||||||||| || | |||||| |
|
|
| T |
39178711 |
caccttcatatatgattctagccgctttaaataatcttctgtactctccaactttccattgtcttctcgataaccaatacttctgaagtaggcctctttt |
39178612 |
T |
 |
| Q |
127 |
gattaaaagatagact |
142 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
39178611 |
gattgaaagatagact |
39178596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University