View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7944_low_7 (Length: 236)
Name: NF7944_low_7
Description: NF7944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7944_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 41 - 220
Target Start/End: Original strand, 3438207 - 3438378
Alignment:
| Q |
41 |
gtgggtgtgttgggggcatgcagnnnnnnnacagtagttcatgcgttgtaaaaatatgtatatagcgttattatctgattgtcagtagtcagtagttgta |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438207 |
gtgggtgtgttgggggcatgcagtttttttacagtatttcatgc-ttgtaaaaatatgtatatagcgttattatctgattgtcagtagtcagtagttgta |
3438305 |
T |
 |
| Q |
141 |
gnnnnnnncttacaaattttagcgtttacacgttatgttcttaatgttgattttacacaacactatctaattgttttatt |
220 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3438306 |
gttttgttcttacaaattttagtgtttacacgttatgttcttaatgtt-------cacaacactatctaattgttttatt |
3438378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University