View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7944_low_8 (Length: 231)
Name: NF7944_low_8
Description: NF7944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7944_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 28541772 - 28541972
Alignment:
| Q |
13 |
gaagaatatgaaccagaaacatgatgaggagcacactttttaattttaagtcgtacatcaccggaccaaccttgagacaatattttaaatagatctttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||| |
|
|
| T |
28541772 |
gaagaatatgaaccagaaacatgatgaggaacacactctttaattttaagtcgtacatcaccgaaacaaccttgagacaatattttgaatagatctttac |
28541871 |
T |
 |
| Q |
113 |
tggcattcattagaattgtcacctcatcttttagtgacattgaatacattaaaattagtttctctcaaggtctctaaaactaatttttcttgtaccatac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28541872 |
gggcattcattagaattgtcacctcatcttttagtgacattgaatacattaaaattagtttctctcaaggtctgtaaaactaatttttcttgtaccatac |
28541971 |
T |
 |
| Q |
213 |
t |
213 |
Q |
| |
|
| |
|
|
| T |
28541972 |
t |
28541972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University