View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7946_high_7 (Length: 226)
Name: NF7946_high_7
Description: NF7946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7946_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 38662681 - 38662872
Alignment:
| Q |
17 |
ataagtggcagagctaacggtacttttccatccataacctacttcactctaaaaaagttactatcagttcatacgttgttagatgcgaatgatattttta |
116 |
Q |
| |
|
||||| |||||||||||| || |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38662681 |
ataagcggcagagctaacagtgcttttccatccagaacctacttcactctaaaaaagttaa-atcagttcatacgttgttagatacgaatgataatttta |
38662779 |
T |
 |
| Q |
117 |
ggacatcaacctaagatttagccctagtatattgtaacaaaaataaagcacataatgaatgtatttaccggtagtagtagagccccaagaatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38662780 |
ggacatcaacctaagatttagccctagtatattgtataaaaaataaagcacataatgaatgtatttaccggtagtagtagagccccaagaatc |
38662872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University