View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7947_high_45 (Length: 203)

Name: NF7947_high_45
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7947_high_45
NF7947_high_45
[»] chr3 (1 HSPs)
chr3 (27-185)||(252821-252979)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 27 - 185
Target Start/End: Complemental strand, 252979 - 252821
Alignment:
27 tagggagctacataaaattaactaaatagttgcgctcaaagagttaatgatttcgaggtatattgtttgaattctttgaataatatcaaagttttttctt 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
252979 tagggagctacataaaattaactaaatagttgcgctcaaagagttaatgacttcgaggtatattgtttgaattctttgaataatatcaaagttttttctt 252880  T
127 tgatagaaacagttttaactaatcatatttttaattaattttagattgaactccacatt 185  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
252879 tgatagaaacagttttaactaatcatatttttaattacttttagattgaactccacatt 252821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University