View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_high_45 (Length: 203)
Name: NF7947_high_45
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 27 - 185
Target Start/End: Complemental strand, 252979 - 252821
Alignment:
| Q |
27 |
tagggagctacataaaattaactaaatagttgcgctcaaagagttaatgatttcgaggtatattgtttgaattctttgaataatatcaaagttttttctt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252979 |
tagggagctacataaaattaactaaatagttgcgctcaaagagttaatgacttcgaggtatattgtttgaattctttgaataatatcaaagttttttctt |
252880 |
T |
 |
| Q |
127 |
tgatagaaacagttttaactaatcatatttttaattaattttagattgaactccacatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
252879 |
tgatagaaacagttttaactaatcatatttttaattacttttagattgaactccacatt |
252821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University