View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_low_28 (Length: 330)
Name: NF7947_low_28
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 4625968 - 4625658
Alignment:
| Q |
1 |
gggatcaaattctcagtctttttatcactctgctcttgtatggattggaagatacaacttgatcttggaccgggttgtaacttctgatccaagatcaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4625968 |
gggatcaaattctcagtctttttatcactctgctcttgtatggattggaagatacaacttgatcttggaccgggttgtaacttctgatccaagatcaggg |
4625869 |
T |
 |
| Q |
101 |
ttacggtccgatatgttcgaaagttagagggggtagtttgagatttttcaggggtctgtgagctatctatgggtgttaaaagagcaattttctaagcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
4625868 |
ttacggtccgatatgttcgaaagttagagggggtagtttgagatttttcaggggtctgtgagctatccatgggtgtt-aaagagcaattttctaagcatt |
4625770 |
T |
 |
| Q |
201 |
tttagtgcaaaagtattcattagcccaaataacactgttattgatcatcaatgagtgatccataaatctcttttgcaaaaaggtctttttgtagctgaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4625769 |
tttagtgcaaaagtattcattagcccaaataacactgttattgatcatcaatgagtgatccataaatctcttttgcaaaaaagtctttttgtagctgaag |
4625670 |
T |
 |
| Q |
301 |
cttttttaggat |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4625669 |
cttttttaggat |
4625658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University