View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_low_40 (Length: 245)
Name: NF7947_low_40
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_low_40 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0015 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 61701 - 61478
Alignment:
| Q |
1 |
aaaggcattataatcaaaacctatgctaagatagagactacatatccagtgcatatatatattatggatgtacatgagaaaatttgggagcatcacctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61701 |
aaaggcattataatcaaaacctatgctaagatagagactaca-atccagtgcatatacat--tatggatgtacatgagaaaatttgggagcatcacctta |
61605 |
T |
|
| Q |
101 |
acttgttatgtgcacgtgggacacacataagaaatcaacaaatgaagagtggtttgaactatgagcacattaaatggttgaccttctccccactcaacat |
200 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61604 |
actta--atgtgcacgtgggacaca--taagaaatcaacaaatgaagagtggtttcaactatgagcacattaaatggttgaccttctccccactcaacat |
61509 |
T |
|
| Q |
201 |
gccccgacctttggaaaatcataagactgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
61508 |
gccccgacctttggaaaatcataagactgat |
61478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University