View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_low_41 (Length: 242)
Name: NF7947_low_41
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 228
Target Start/End: Complemental strand, 18203767 - 18203567
Alignment:
| Q |
27 |
aaatataaagtgatataaattaactatcacatctttagcaaaggttatcaattttgtaatnnnnnnnntgttaagttttactctagtaaattcatgtttt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| |
|
|
| T |
18203767 |
aaatataaagtgatataaattaactatcacatctttagcaaaggttatcaattttgtaataaaaaaaatgttaagttttactctagcaaatttatgtttt |
18203668 |
T |
|
| Q |
127 |
tgttttatgtgttaagccaaatttcaaatattgcactacgttgacatttattcttttgaaaaacaaggataaattacactttttattctttaagttattt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18203667 |
-gttttatgtgttaagccaaatttcaaatattgcactacgttgacatttattcttttgaaaaacaaggataaattacactttttattctttaagttattt |
18203569 |
T |
|
| Q |
227 |
tt |
228 |
Q |
| |
|
|| |
|
|
| T |
18203568 |
tt |
18203567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University