View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_low_42 (Length: 234)
Name: NF7947_low_42
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 34883459 - 34883239
Alignment:
| Q |
1 |
ccacgtaatatgcatgtaaatcacaaactcagtcatgaatgatccttgtctaaggaaaatccaacggtgacaagtattactatgttcctagatagactag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34883459 |
ccacgtaatatgcatgtaaatcacaaactcactcatgaatgatccttgtctaaggaaaatccaacggtgac-agtattactatgttcctagatagactag |
34883361 |
T |
|
| Q |
101 |
actagattttgtaggtagtaaaacaaggtaacagtag---nnnnnnnnnnnnnnnnnngtcttgctgagtgaagatgaccaattttgttggactaaggtt |
197 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34883360 |
actagattttgtaggtagcaaaacaaggtaacagtagtatcatcatcatcatcatcatgtcttgctgagtgaagatgaccaattttgttggactaaggtt |
34883261 |
T |
|
| Q |
198 |
accagttatgtcctgttattgt |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34883260 |
accagttatgtcctgttattgt |
34883239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University