View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7947_low_43 (Length: 233)
Name: NF7947_low_43
Description: NF7947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7947_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 8937707 - 8937925
Alignment:
| Q |
1 |
aatcaaccaactggaagattcagcaatggtttagtcccttcagacatcattggtacaaaaataattcttgtcccgttacaatgcgaacctttatattgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8937707 |
aatcaaccaactggaagattcagcaatggtttagtcccttcagacatcattggtacaaaaataattcttgtcccgttacaatgcgaacctttatattgtg |
8937806 |
T |
|
| Q |
101 |
gataatgcagccaatatagttatttatattgcggtagcagaccgcaatttaaaaccatttatacataggagaaaaattagaatgaacaannnnnnncatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8937807 |
gataatgcagccaatatagttatttatattgcggtagcagaccgcaatttaaaaccatttatacataggagaaaaattagaatgaacaatttttttcatg |
8937906 |
T |
|
| Q |
201 |
attcttaataacaagttca |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8937907 |
attcttaataacaagttca |
8937925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 8945892 - 8945954
Alignment:
| Q |
1 |
aatcaaccaactggaagattcagcaatggtttagtcccttcagacatcattggtacaaaaata |
63 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8945892 |
aatcaaccaacaggaaggtttagcaatggtttagtcccttcagacatcattggtacaaaaata |
8945954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 60
Target Start/End: Complemental strand, 31797541 - 31797488
Alignment:
| Q |
7 |
ccaactggaagattcagcaatggtttagtcccttcagacatcattggtacaaaa |
60 |
Q |
| |
|
|||||||| || |||||||||||||||||||| |||||| | ||||||||||| |
|
|
| T |
31797541 |
ccaactggcaggttcagcaatggtttagtcccatcagaccttgttggtacaaaa |
31797488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University