View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7948_high_13 (Length: 228)

Name: NF7948_high_13
Description: NF7948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7948_high_13
NF7948_high_13
[»] chr1 (2 HSPs)
chr1 (20-91)||(13618815-13618886)
chr1 (20-87)||(52041840-52041907)
[»] chr5 (1 HSPs)
chr5 (20-88)||(1689478-1689546)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 13618886 - 13618815
Alignment:
Q  20 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagctccaa 91  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  13618886 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagctccaa 13618815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 52041840 - 52041907
Alignment:
Q  20 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagct 87  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  52041840 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagct 52041907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 1689478 - 1689546
Alignment:
Q  20 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagctc 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1689478 ccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagctc 1689546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University