View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7948_low_2 (Length: 387)

Name: NF7948_low_2
Description: NF7948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7948_low_2
NF7948_low_2
[»] chr4 (1 HSPs)
chr4 (19-342)||(6274487-6274807)


Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 342
Target Start/End: Original strand, 6274487 - 6274807
Alignment:
19 gagtcaagaattcaacaatcatcctattgtgaaagagaatctccctccaaaagatggactcctcggctttttcaaatctcgatatgcagcgattagtgct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6274487 gagtcaagaattcaacaatcatcctattgtgaaagagaatctccctccaaaagatggactcctcggctttttcaaatctcgatatgcagcgattagtgct 6274586  T
119 gcttcgaaatagaccgatttcaagagtgatgccacatgctgcagagctgttggattaagagagataaataggttagtctttagactaatcccagaaataa 218  Q
    |||||||||||||| ||||||| |||||||||| ||||||  ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
6274587 gcttcgaaatagactgatttcaggagtgatgccgcatgctcgagagccgttggattaagagagataaataggttggtctttagactaatcccagaaataa 6274686  T
219 agcaaagttcactcgttttagtttatttgagcagtattttgagtgttattatcacttatgatgagtacaaatttgatatttatatttagtttaagtatcc 318  Q
    || ||| ||||||| ||||||||||||||||| ||||||||||| ||||| ||||||   |||||||||||||||||||||||| |||||| |||| |||    
6274687 agaaaatttcactcattttagtttatttgagctgtattttgagttttattgtcactt---atgagtacaaatttgatatttataattagttcaagtctcc 6274783  T
319 tatttaatatgtagtgcaatctta 342  Q
    ||| | ||||| ||||| ||||||    
6274784 tatatgatatggagtgctatctta 6274807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University