View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7949_high_18 (Length: 333)

Name: NF7949_high_18
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7949_high_18
NF7949_high_18
[»] chr1 (13 HSPs)
chr1 (9-166)||(46031442-46031599)
chr1 (9-66)||(30412998-30413055)
chr1 (130-201)||(30413101-30413172)
chr1 (9-68)||(20012810-20012869)
chr1 (9-68)||(24969902-24969961)
chr1 (9-68)||(25430742-25430801)
chr1 (126-212)||(30097564-30097650)
chr1 (9-68)||(30097690-30097749)
chr1 (140-212)||(20012926-20012998)
chr1 (140-191)||(24969794-24969845)
chr1 (140-191)||(25430858-25430909)
chr1 (221-255)||(30413742-30413776)
chr1 (238-268)||(30413841-30413871)
[»] scaffold0046 (2 HSPs)
scaffold0046 (9-68)||(87004-87063)
scaffold0046 (127-212)||(87107-87192)
[»] chr6 (1 HSPs)
chr6 (12-161)||(22689688-22689837)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 13)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 9 - 166
Target Start/End: Original strand, 46031442 - 46031599
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccaccagtagatttcttgaaaacaggcgcttcggctagagacactc 108  Q
    ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| || |||||||||| |||| |||||||||||||||||||    
T  46031442 aatgcagatgaaccccccaacctagagatgccaactgccacgttcgcaggagcaccaccaggagctttcttgaaagcaggtgcttcggctagagacactc 46031541  T
Q  109 cacccactgttggcacaaaatctattaccatttcaccaaaacaaacaaccagtccact 166  Q
    ||||||| || |||||||||||||| | || ||||||||||||||| |||||||||||    
T  46031542 cacccaccgtaggcacaaaatctatcaacaattcaccaaaacaaacgaccagtccact 46031599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 30412998 - 30413055
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccac 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30412998 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccac 30413055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 130 - 201
Target Start/End: Original strand, 30413101 - 30413172
Alignment:
Q  130 ctattaccatttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatgagatcatcag 201  Q
    |||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||    
T  30413101 ctattaacatttcaccaaaacaaacaaccagtccacttgtttcgttgcagccttctgttaggagatcatcag 30413172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 20012810 - 20012869
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccacca 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  20012810 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaatagcaccacca 20012869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 24969961 - 24969902
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccacca 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  24969961 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaatagcaccacca 24969902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 25430742 - 25430801
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccacca 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  25430742 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaatagcaccacca 25430801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 126 - 212
Target Start/End: Complemental strand, 30097650 - 30097564
Alignment:
Q  126 aaatctattaccatttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatgagatcatcaggtaatctgtag 212  Q
    |||||||| | || ||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||  |||||||||| |||||    
T  30097650 aaatctatcaacagttcaccaaaacaaacaaccagtccacttgttttgctgcagccttctgttatgggaaaatcaggtaatttgtag 30097564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 30097749 - 30097690
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccacca 68  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||  ||||||||||    
T  30097749 aatgcagatgaacctcccaacttagagatgccaactgccacgtttgcaatagcaccacca 30097690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 140 - 212
Target Start/End: Original strand, 20012926 - 20012998
Alignment:
Q  140 ttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatgagatcatcaggtaatctgtag 212  Q
    ||||||||||||||||||||||||||| |||||| || |||||||||||| | ||  |||||||||| |||||    
T  20012926 ttcaccaaaacaaacaaccagtccacttgttttgctgtagccttctgttacgggaaaatcaggtaatttgtag 20012998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 24969845 - 24969794
Alignment:
Q  140 ttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatg 191  Q
    |||| |||||||||||||||||||||  |||||| |||||||||||||||||    
T  24969845 ttcatcaaaacaaacaaccagtccaccagttttgctgcagccttctgttatg 24969794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 25430858 - 25430909
Alignment:
Q  140 ttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatg 191  Q
    |||| |||||||||||||||||||||  |||||| |||||||||||||||||    
T  25430858 ttcatcaaaacaaacaaccagtccaccagttttgctgcagccttctgttatg 25430909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 255
Target Start/End: Original strand, 30413742 - 30413776
Alignment:
Q  221 aaatgaaaatcaacctatctataatcatggttatt 255  Q
    |||| ||||||||||||||||||||||||||||||    
T  30413742 aaattaaaatcaacctatctataatcatggttatt 30413776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 238 - 268
Target Start/End: Original strand, 30413841 - 30413871
Alignment:
Q  238 tctataatcatggttattactatatgatcac 268  Q
    |||||||||||||||||||||||||||||||    
T  30413841 tctataatcatggttattactatatgatcac 30413871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: scaffold0046
Description:

Target: scaffold0046; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 87004 - 87063
Alignment:
Q  9 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccacca 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  87004 aatgcagatgaaccccccaacttagagatgccaactgccacgtttgcaatagcaccacca 87063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 87107 - 87192
Alignment:
Q  127 aatctattaccatttcaccaaaacaaacaaccagtccactcgttttgttgcagccttctgttatgagatcatcaggtaatctgtag 212  Q
    ||||||| | || ||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||  |||||||||| |||||    
T  87107 aatctatcaacagttcaccaaaacaaacaaccagtccacttgttttgctgcagccttctgttatgggaaaatcaggtaatttgtag 87192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 161
Target Start/End: Complemental strand, 22689837 - 22689688
Alignment:
Q  12 gcagatgaaccccccaacttagagatgccaactgccacgtttgcaggagcaccaccagtagatttcttgaaaacaggcgcttcggctagagacactccac 111  Q
    ||||||||||| |||||  |||| || ||||| || || || |||||||| ||||||| ||||||||||||| | || || ||||| || |||||||| |    
T  22689837 gcagatgaacctcccaatctagatataccaacagcaacattagcaggagctccaccaggagatttcttgaaagccggtgcctcggcgagcgacactcctc 22689738  T
Q  112 ccactgttggcacaaaatctattaccatttcaccaaaacaaacaaccagt 161  Q
    |||| ||||||||||| ||||| | |||||| |||||  |||||||||||    
T  22689737 ccacagttggcacaaagtctatcaacatttccccaaaggaaacaaccagt 22689688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University