View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_high_19 (Length: 278)
Name: NF7949_high_19
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 49 - 264
Target Start/End: Complemental strand, 33887227 - 33887006
Alignment:
| Q |
49 |
aattttgagagggaagagcggaagagatttgctgagaagtaagaatataataaaactaccacctgctataaattattttaacttttattttgaaatgagt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887227 |
aattttgagagggaagagcggaagagatttgctgagaagtaagtatataataaaactaccacctgctataaattattttaacttttattttgaaatgagt |
33887128 |
T |
 |
| Q |
149 |
gacacaagatacggaatgtgagcagtgatctattccctgtcc------ctgtgcagtggcagaatcaaaccctaactaactaacaactttgctgcgttgt |
242 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33887127 |
gacacaagataaggaatgtgagcagtgatctattccctgtccctgtccctgtgcagtggcagaatcaaaccctaactaaccaacaactttactgcgttgt |
33887028 |
T |
 |
| Q |
243 |
ttgtaggtacaactttgatatt |
264 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33887027 |
ttgtaggtacaactttgatatt |
33887006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University