View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7949_high_20 (Length: 261)

Name: NF7949_high_20
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7949_high_20
NF7949_high_20
[»] chr2 (2 HSPs)
chr2 (1-102)||(15363174-15363276)
chr2 (44-91)||(3541236-3541284)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 15363174 - 15363276
Alignment:
1 taacaatatgatattatttcatgtgtttttacatacctgatagtgacatgataaaa--tatatatttaattgacaaaattatccttgtgaaatatatact 98  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||    
15363174 taacaatatgatattatttcatgtatttttacatacttgatagt-acatgataaaacgtatatatttaattgacaaaattatccttgtgaaatatatact 15363272  T
99 atat 102  Q
    ||||    
15363273 atat 15363276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 3541236 - 3541284
Alignment:
44 tgacatgataaaatatatatt-taattgacaaaattatccttgtgaaat 91  Q
    ||||||||||||||||||||  ||| |||||||||||||||||||||||    
3541236 tgacatgataaaatatatatcataaatgacaaaattatccttgtgaaat 3541284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University