View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_low_14 (Length: 392)
Name: NF7949_low_14
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 37274085 - 37273826
Alignment:
| Q |
1 |
tgggcagctgtgtttgtgcttgtttttctctcccactcttgaacactttgcctgtgctcggatgtgactatttttattcatcggtttgttttgttgttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37274085 |
tgggcagctgtgtttgtgcttgtttttctctcccactcttgaacactttgcctcagctcggatgtgactatttttattcatcggtttgttttgttgttgc |
37273986 |
T |
|
| Q |
101 |
aaaaaatattatgcaaatgtattgttcatcatttagctaaattaacttcatcttccaatgatactattttgatgaatggttgatgagttgatcttgatga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37273985 |
aaaaaatattattcaaatgtattgttcatcatttagctaaattaacttcatcttccaatgatactattttgatgaatggttgatgaggtgatcttgatga |
37273886 |
T |
|
| Q |
201 |
agctgctgggtttggatggaagatgatgaatggtgttggtgatgaatcatgtgttccttc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37273885 |
agctgctgggtttggatggaagatgatgaatggtgttggtgatgaatcatgtgttccttc |
37273826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University