View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_low_23 (Length: 261)
Name: NF7949_low_23
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 15363174 - 15363276
Alignment:
| Q |
1 |
taacaatatgatattatttcatgtgtttttacatacctgatagtgacatgataaaa--tatatatttaattgacaaaattatccttgtgaaatatatact |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15363174 |
taacaatatgatattatttcatgtatttttacatacttgatagt-acatgataaaacgtatatatttaattgacaaaattatccttgtgaaatatatact |
15363272 |
T |
 |
| Q |
99 |
atat |
102 |
Q |
| |
|
|||| |
|
|
| T |
15363273 |
atat |
15363276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 3541236 - 3541284
Alignment:
| Q |
44 |
tgacatgataaaatatatatt-taattgacaaaattatccttgtgaaat |
91 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
3541236 |
tgacatgataaaatatatatcataaatgacaaaattatccttgtgaaat |
3541284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University