View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_low_24 (Length: 252)
Name: NF7949_low_24
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 45318021 - 45318184
Alignment:
| Q |
21 |
aaacgtctttctattattggatggatatgtatggtttttaacatatgtgtatttgcttctcctctcttcattttggtgagaatttgatatcatttcttaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45318021 |
aaacgtctttctattattggatggatatgtatggtttttaacatatgtgtatttgcttctcctctctttattttggtgagaatttgatatcatttcttaa |
45318120 |
T |
|
| Q |
121 |
cttttatgttttggccatttgttttacggtagttaatagagtcagtcatgctaacaacctgacc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318121 |
cttttatgttttggccatttgttttacggtagttaatagagtcagtcatgctaacaacctgacc |
45318184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 89
Target Start/End: Original strand, 40404840 - 40404908
Alignment:
| Q |
21 |
aaacgtctttctattattggatggatatgtatggtttttaacatatgtgtatttgcttctcctctcttc |
89 |
Q |
| |
|
||||||||| |||| ||||||||||| || | ||||| |||||| ||||||||||| | ||||||||| |
|
|
| T |
40404840 |
aaacgtcttgctatcattggatggatttgccttgttttcaacataagtgtatttgctgcacctctcttc |
40404908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University