View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7949_low_25 (Length: 236)

Name: NF7949_low_25
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7949_low_25
NF7949_low_25
[»] chr5 (1 HSPs)
chr5 (1-222)||(36198056-36198277)
[»] chr1 (1 HSPs)
chr1 (5-108)||(48676371-48676474)


Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 36198277 - 36198056
Alignment:
1 agcgccatagatgagtccacctcttggaaagaatggaagtggtaacagcgtttttggtagggttgaaagatagaatgtggcacaggatatcatctggtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36198277 agcgccatagatgagtccacctcttggaaagaatggaagtggtaacagcgtttttggtagggttgaaagatagaatgtggcacaggatatcatctggtaa 36198178  T
101 attgcttattctatcctcgcatggctccattgctgaaagaggttagaggcagctaaagaagcagaacggttttcagttgtattcaaattcgagggagagg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
36198177 attgcttattctatcctcgcatggctccattgctgaaagaggttagaggcagctaaagaagcagaacggttttcagttgtattcaaattcgaggaagagg 36198078  T
201 gatgctggggacggttggtttt 222  Q
    ||||||||||||||||||||||    
36198077 gatgctggggacggttggtttt 36198056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 48676371 - 48676474
Alignment:
5 ccatagatgagtccacctcttggaaagaatggaagtggtaacagcgtttttggtagggttgaaagatagaatgtggcacaggatatcatctggtaaattg 104  Q
    |||||||||| |||||||||| |||||||    |||| |||| |||| ||||||||| |||||||| ||||||||||  ||||||||||||| |||| ||    
48676371 ccatagatgaatccacctctttgaaagaactccagtgataacggcgtctttggtaggattgaaagagagaatgtggcgaaggatatcatctgataaactg 48676470  T
105 ctta 108  Q
    ||||    
48676471 ctta 48676474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University