View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_low_28 (Length: 226)
Name: NF7949_low_28
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 33 - 210
Target Start/End: Original strand, 51595486 - 51595663
Alignment:
| Q |
33 |
aacaggaaaaggacaagaccttaaaactaaacatgaacaaagttgtttgcctttatgccctttcagggctctttgcaggtgccattttcagctcatgcat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51595486 |
aacaggaaaaggacaagaccttaaaactaaacatgaacaaagttgtttgcctttatgccctttcagggctctttgcaggtgccattttcagctcatgcat |
51595585 |
T |
|
| Q |
133 |
ttttgaaactccaaggaattataaagcagagaatgattgcaatctctttgacaatattggtgagtttacccttgtatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51595586 |
ttttgaaactccaaggaattataaagcagagaatgattgcaatctatttgacaatattggtgagtttacccttgtatt |
51595663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 56 - 132
Target Start/End: Original strand, 51599819 - 51599895
Alignment:
| Q |
56 |
aaactaaacatgaacaaagttgtttgcctttatgccctttcagggctctttgcaggtgccattttcagctcatgcat |
132 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51599819 |
aaactaaaaatgaacaaaggtgtctgcctttatgccctttcagggctttttgcaggtgccattttcagctcatgcat |
51599895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 51599904 - 51599941
Alignment:
| Q |
161 |
gagaatgattgcaatctctttgacaatattggtgagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51599904 |
gagaatgattgcaatctctttgacaatattggtgagtt |
51599941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University