View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7949_low_32 (Length: 204)
Name: NF7949_low_32
Description: NF7949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7949_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 10 - 183
Target Start/End: Complemental strand, 42489140 - 42488966
Alignment:
| Q |
10 |
gtgagaagaatagcgatagttgacgagctgatgttgatgtataaaggctcgcccgccccataaggcccaacgcaaaacccatctggacatacaccgccga |
109 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42489140 |
gtgagaaaaatagcgatagttgacgagttgatgttgatgtataaaggctcgcccgacccataaggcccaacgcaaaacccatctggacatacaccgccga |
42489041 |
T |
|
| Q |
110 |
g-aatagtgaattcgtctaccataagaacaaagcacgcgccaacgattacgagtttagggtttcaaaattaactc |
183 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42489040 |
gaaatagtgaattcgtctaccaaaagaacaaagcacgcgccaacgattacgagtttagggtttcaaaattaactc |
42488966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 135 - 183
Target Start/End: Complemental strand, 42499252 - 42499204
Alignment:
| Q |
135 |
aacaaagcacgcgccaacgattacgagtttagggtttcaaaattaactc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42499252 |
aacaaagcacgcgccaacgattacgagtttagggtttcaaaattaactc |
42499204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University