View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_high_34 (Length: 300)
Name: NF7950_high_34
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 292
Target Start/End: Complemental strand, 45403838 - 45403574
Alignment:
| Q |
18 |
ggtggatagttgaaggcaaccataatcaagaggcactggtagggtagggactcatatctagctaaacttcataagagtgaannnnnnnggtcttaaccct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45403838 |
ggtggatagttgaaggcaaccataatcaagaggcactggtagggtagggactcatatctagctaaacttcataagagtgaatttttttggtcttaaccct |
45403739 |
T |
|
| Q |
118 |
tcgatgctcctcgatggaacggggcccacataatctgacgttcgaccgagaagtaagtaaaatcaagtaaaaaattgttggagcgagtcaggattcaaag |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45403738 |
tcgatgctcctcgagggaacggggcccacataatctgacgttcgaccgagaagt----------aagtaaaaaattgttcgagcgagtcaggattcaaag |
45403649 |
T |
|
| Q |
218 |
tgaagatttaaaactgtatagaaatagttctgcatttatttcattcattctttacaggattcatgtattcttctc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403648 |
tgaagatttaaaactgtatagaaatagttctgcatttatttcattcattctttacaggattcatgtattcttctc |
45403574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University