View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_high_38 (Length: 281)
Name: NF7950_high_38
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 32 - 265
Target Start/End: Original strand, 1445250 - 1445483
Alignment:
| Q |
32 |
tggtgttgagcctctcgctgggggactttgttttgtaccttttctcttctggcagccagtcttacctgcacaacctcaatagttttctgtcagcgttctt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445250 |
tggtgttgagcctctcgctgggggactttgttttgtaccttttctcttctggcagccagtcttacctgcacaacctcaatagttttctgtcagcgttctt |
1445349 |
T |
 |
| Q |
132 |
gtctttgtcgccattcaactacaaggcttgtgttggtttgttctattttcagtttttctagacggtggtttgtgcttccggtcttctggttcgttgaaac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445350 |
gtctttgtcgccattcaactacaaggcttgtgttggtttgttctattttcagtttttctagacggtggtttgtgcttccggtcttctggttcgttgaaac |
1445449 |
T |
 |
| Q |
232 |
tcgactttaagggtcgtgtttcagacgttctttt |
265 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
1445450 |
tcgactttaagggtcgtgtttcagaggttctttt |
1445483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University