View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7950_high_44 (Length: 220)

Name: NF7950_high_44
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7950_high_44
NF7950_high_44
[»] chr1 (1 HSPs)
chr1 (144-203)||(48266752-48266810)


Alignment Details
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 144 - 203
Target Start/End: Complemental strand, 48266810 - 48266752
Alignment:
144 agttacacatgatagacaattcatccgagtctatctaattgtttatcatgtgatcatatt 203  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
48266810 agttacacatgatagacaattcatccgagtctatctaa-tgtttatcatgtgatcatatt 48266752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University