View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_high_44 (Length: 220)
Name: NF7950_high_44
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 144 - 203
Target Start/End: Complemental strand, 48266810 - 48266752
Alignment:
| Q |
144 |
agttacacatgatagacaattcatccgagtctatctaattgtttatcatgtgatcatatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48266810 |
agttacacatgatagacaattcatccgagtctatctaa-tgtttatcatgtgatcatatt |
48266752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University