View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_low_51 (Length: 249)
Name: NF7950_low_51
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 37613881 - 37613651
Alignment:
| Q |
1 |
acggttttttagtcacctcagtgtagtaattctataaaataattatttattttatgtgaaattttttaaactatagctccaccttctcagcggattttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
37613881 |
acggttttttagtcacctcagtgtagtaattttataaaataattatttattttatgtgaaattttttaaactatagcttcaccttctcaacggattttat |
37613782 |
T |
|
| Q |
101 |
gtgcttataaatttggatatgggtttctttgccacatcatagtaattttataaaatattgatctaatttatttgctaaatttcgttaatttatcgtagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37613781 |
gtgcttataaatttggatatgggtttctttgccacatcatagtaattttataaaatattgatctaatttatttgctaaatttcgttaatttattgtagtg |
37613682 |
T |
|
| Q |
201 |
tcctcgttgggattttatgtgcttacgaatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37613681 |
tcctcgttgggattttatgtgcttacgaatt |
37613651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University