View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_low_56 (Length: 216)
Name: NF7950_low_56
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 14 - 199
Target Start/End: Complemental strand, 50885142 - 50884954
Alignment:
| Q |
14 |
ggtgttaattttaatgggttagtttaatttcgtcnnnnnnngtattacttagatgatacacttgaaaaaatactaattaatattaatttaaaactgcaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
50885142 |
ggtgttaattttaatgggttagtttaatttcgtcaaaaaaagtattacttagatgatacacttaaataaatactaattaatattaatttaaaactgcaat |
50885043 |
T |
 |
| Q |
114 |
aagtcatttatttttgaac---nnnnnnnnnacaaacgagtcgctcattagagatagaaatattttccgctcatttgagagagaaatat |
199 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50885042 |
aagtcatttatttttgaacttttttttttacaaaaacgagtcgctcattagagagagaaatattttccgctcatttgagagagaaatat |
50884954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University