View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7950_low_57 (Length: 204)
Name: NF7950_low_57
Description: NF7950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7950_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 4216889 - 4216800
Alignment:
| Q |
18 |
atgttctccaattcggcaatttaggaggatattcgaatatatatcggtctattctttgtctaatctagttggcttctgtgtgtattattt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4216889 |
atgttctccaattcggcaatttaggaggatattcgaagacatatcggtctattctttgtctgatctagttggcttctgtgtgtattattt |
4216800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 109 - 187
Target Start/End: Complemental strand, 4216770 - 4216700
Alignment:
| Q |
109 |
acaagcaagtttcgatgcaactattatttgacaaaataaacctttgaaccttttcatggttaaaagtgaatcgtggtat |
187 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4216770 |
acaagcaagtttcgatgcaactatcatttgaaaaaataaac--------cttttcatggttaaaagtgaatcgtggtat |
4216700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University