View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7951_low_5 (Length: 262)
Name: NF7951_low_5
Description: NF7951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7951_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 29 - 187
Target Start/End: Complemental strand, 5088917 - 5088759
Alignment:
| Q |
29 |
gaaatgaagaagtgttacttatatgtacaccaatatatatttcaatagatgaaagaattaaaatcgaagtgtttatttgttacataagttgtttgcatgc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
5088917 |
gaaatgaagaagtgttacttatatgtacaccaacatatatttcaatagatgaaagaattcaaatcaaagtgtttatttgtaacataagttgtttgcatgc |
5088818 |
T |
 |
| Q |
129 |
atgagaattttgtcttatcgtgtattattaactttatggcatcttgtaattgttgcatc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5088817 |
atgagaattttgtcttatcgtgtattattaactttatggcatcttgtaattcttgcatc |
5088759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 242
Target Start/End: Complemental strand, 5088732 - 5088704
Alignment:
| Q |
214 |
tttgtaatcttgttttattataattatta |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5088732 |
tttgtaatcttgttttattataattatta |
5088704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University