View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7951_low_7 (Length: 259)
Name: NF7951_low_7
Description: NF7951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7951_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 13592772 - 13592862
Alignment:
| Q |
18 |
ttctcctactattttcaatatttctccatcgcaagccactgatattcccaaccttcactgctactggtccagtctttttgtgccttctttt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13592772 |
ttctcctactattttcaatatttctccatcgcaagccactgatattcccaaccttcactgctactggtccagtctttttctaccttctttt |
13592862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 82 - 252
Target Start/End: Original strand, 24315444 - 24315614
Alignment:
| Q |
82 |
tggtccagtctttttgtgccttctttttagccatgccgtttgattggcaggccgaatttgttgtaccgggggctccagcaccttctgtgcgggttcatct |
181 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||||||||| || | ||| |||| ||||||| | || ||| ||||||||| | |
|
|
| T |
24315444 |
tggtccggtctttttgtgctttctccgcggccatgccgtttgattggcaggccagatattttgcaccgacggctccaacttctactgcgcgggttcagcc |
24315543 |
T |
|
| Q |
182 |
tgtataaccggtgaaagcttctgctccggcgccttcatttgctcaggtgttgtcctcatcgcaaactactc |
252 |
Q |
| |
|
|||| || ||||||||||| |||||| |||||||| |||||||| |||||||||| || |||||||||| |
|
|
| T |
24315544 |
tgtacaatcggtgaaagctactgctcttgcgccttcctttgctcaattgttgtcctcgtcacaaactactc |
24315614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University