View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7952_low_5 (Length: 253)
Name: NF7952_low_5
Description: NF7952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7952_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 15365569 - 15365782
Alignment:
| Q |
19 |
atgtaacatgtgtttggtgtcagaaacgtgagagtctgaccctgacacgtgtcggacaccagacacactttaatgtatagtgtcactgctacatacaccc |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15365569 |
atgtaacatgtgtttggtgtcagacacgtgaaagtctgaccctgacacgtgtcggacaccagacacactttaatgtatagtgtcactgctacatacaccc |
15365668 |
T |
|
| Q |
119 |
atgaattatggcatgaatgatggtcttgattagcccttttctaacaatatttgtaaacacaaaagagaaaacttggagtgggggaggttgcatgttaaca |
218 |
Q |
| |
|
|| ||||||||||||||||||||| | |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15365669 |
ataaattatggcatgaatgatggtttggattagcccttt----------tttgcaaacacaaaagagaaaacttggagtgggggaggttgcatgttaaca |
15365758 |
T |
|
| Q |
219 |
acttattatcattattgctcctat |
242 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
15365759 |
acttattgccattattgctcctat |
15365782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 61 - 114
Target Start/End: Original strand, 25792374 - 25792427
Alignment:
| Q |
61 |
tgacacgtgtcggacaccagacacactttaatgtatagtgtcactgctacatac |
114 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
25792374 |
tgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatac |
25792427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University