View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7953_low_5 (Length: 224)
Name: NF7953_low_5
Description: NF7953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7953_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 8 - 147
Target Start/End: Original strand, 29541563 - 29541702
Alignment:
| Q |
8 |
agagagatgaacaagattgtgagaaaattggaaaaccctagatttgaaatgggggaaggaagaagtggatggaaacggcgcatgacaagctcgctcttgt |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
29541563 |
agagaaatgaacaagattgtgagaaaattggaaaaccctagatttcaaatgggggaaggaaaaagtggatggaaacggcgcatgacaaattagctcttgt |
29541662 |
T |
|
| Q |
108 |
gtgcctctttatataatgaatgaatctatgattttacctt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29541663 |
gtgcctctttatataatgaatgaatctatgattttccctt |
29541702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 39898936 - 39898885
Alignment:
| Q |
173 |
cccctcttttatgttttatgttgatcttttcatgaaattttatatcaacact |
224 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39898936 |
cccctcatttatgttttatgttgatctgttcatgaaattttatatcaacact |
39898885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University